View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15635_high_6 (Length: 307)
Name: NF15635_high_6
Description: NF15635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15635_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 20694103 - 20694401
Alignment:
| Q |
1 |
aaccttatgtggtcgacaaagttggccggacaattacatttggaccggatgacttgactgttcagttagtggccgaaccttttgtcgatggtgctggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20694103 |
aaccttatgtggtcgacaaagttggccggacaattacatttgaaccggatgacttgactgttcagttagtggccgaaccttttgtcgatggtgctggtgg |
20694202 |
T |
 |
| Q |
101 |
gagagtaaaatttttggtggaaaatgagggtggtttgttgctagtggatatttatgagatttgtttgtcctattacctcgatgaagatgctttaagaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20694203 |
gagagtaaaatttttggtggaaaatgagggtgatttgttgctagtggatatttatgagatttgtttgtcctattacctcgatgaagatgctttaagaatt |
20694302 |
T |
 |
| Q |
201 |
tatgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20694303 |
tatgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttttctgct |
20694401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 13)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 210 - 299
Target Start/End: Original strand, 9494819 - 9494908
Alignment:
| Q |
210 |
aggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
||||||||||| ||||||| || |||||||| ||||| ||||| ||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
9494819 |
aggcttgatgagaaggagatgagatgggtgaatttgatgagtttaggggatagggttttgttcttggggaatggatgttcgttttctgct |
9494908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 202 - 299
Target Start/End: Complemental strand, 41985741 - 41985644
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| | ||| | ||||| |||||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
41985741 |
atgtgttcagacttgatgagaaggagaagaaatgggtcaagttggcgagtttaggggatagagttttgttcttggggaatggatgttcgttttctgct |
41985644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 298
Target Start/End: Original strand, 9695610 - 9695715
Alignment:
| Q |
193 |
taagaatttatgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgtt |
292 |
Q |
| |
|
|||| ||| |||| |||||||||||||| ||||||||||| ||||| | ||||| | ||| |||||||||||||||||||||||| | | |||||||| |
|
|
| T |
9695610 |
taagtattgatgtattcaggcttgatgagaaggagaagaagtgggtcaagttgaccaatttaggggatagggttttgtttttgggggaagactgttcgtt |
9695709 |
T |
 |
| Q |
293 |
ctctgc |
298 |
Q |
| |
|
|||||| |
|
|
| T |
9695710 |
ctctgc |
9695715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 292
Target Start/End: Complemental strand, 41980967 - 41980877
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgtt |
292 |
Q |
| |
|
||||||| ||||||| | | || |||||||||||||| | ||||| ||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41980967 |
atgtgtttaggcttgctaagaaagagaagaaatgggtcaagttgacgagtttaggggatagagttttgttcttggggaatggatgttcgtt |
41980877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 299
Target Start/End: Complemental strand, 9448427 - 9448330
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
||||||| | |||| |||| ||||||||||||||||||| || |||| ||| |||||||| |||||||| |||||||||| |||||||| |||||| |
|
|
| T |
9448427 |
atgtgtttaagctttatgagaaggagaagaaatgggtgaagttaacaactttaggggatagtgttttgttcttggggaatgactgttcgttttctgct |
9448330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 217 - 298
Target Start/End: Original strand, 9655375 - 9655456
Alignment:
| Q |
217 |
atgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgc |
298 |
Q |
| |
|
|||| ||||||||||||||||||| |||| | ||| ||||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
9655375 |
atgagaaggagaagaaatgggtgaagttgatgaatttaggggatagggttttgtttttgggcgaaggatgttcgttttctgc |
9655456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 9485972 - 9486048
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||| ||| || ||||||||||| |||||||||||||||| |
|
|
| T |
9485972 |
atgtgtttaggcttgatgagaaggagaagaagtgggtggaggtgagaaatttgggggatatggttttgtttttgggg |
9486048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 299
Target Start/End: Complemental strand, 9353004 - 9352917
Alignment:
| Q |
212 |
gcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
||||||||| | ||||||||| ||||||| |||| || || |||| ||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
9353004 |
gcttgatgagatggagaagaagtgggtgaagttgaaaaaattagggggtagggttttgtttgtggggagtggatgttcgttttctgct |
9352917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 299
Target Start/End: Original strand, 9617468 - 9617563
Alignment:
| Q |
204 |
gtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
||||||||| || |||| || |||||||||||||||| |||| || ||| ||||||||||||||||| | | |||||||||||| || |||||| |
|
|
| T |
9617468 |
gtgttcaggtttcatgagaaagagaagaaatgggtgaagttgaaaaatttaggggatagggttttgttccttgtgaatggatgttcattttctgct |
9617563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 274
Target Start/End: Original strand, 9626498 - 9626555
Alignment:
| Q |
217 |
atgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgttttt |
274 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| | ||| |||||||||||||||||||| |
|
|
| T |
9626498 |
atgagaaggagaagaaatgggtgaatttgatgaatttaggggatagggttttgttttt |
9626555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 298
Target Start/End: Original strand, 9646382 - 9646463
Alignment:
| Q |
217 |
atgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgc |
298 |
Q |
| |
|
|||| ||||||||||||||||||| |||| | ||| |||||||||||||||||||| || | ||||||||||| ||||| |
|
|
| T |
9646382 |
atgagaaggagaagaaatgggtgaagttgatgaatttaggggatagggttttgttttttggcgaaggatgttcgttttctgc |
9646463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 278
Target Start/End: Complemental strand, 13864317 - 13864241
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
||||||| ||||||||||| | |||||| || |||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
13864317 |
atgtgtttaggcttgatgagagggagaaaaagtgggtggaggtgagaaatttgggggatagggttttgtttttgggg |
13864241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 299
Target Start/End: Complemental strand, 9336597 - 9336556
Alignment:
| Q |
258 |
gatagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
9336597 |
gataaggttttgttcttggggaatggatgttcgttttctgct |
9336556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 204 - 298
Target Start/End: Complemental strand, 4428742 - 4428648
Alignment:
| Q |
204 |
gtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctgc |
298 |
Q |
| |
|
||||| ||||||||||| |||| | |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
4428742 |
gtgtttaggcttgatgagaaggcgcgtaaatgggtgaaattgacgagtttgggggatagggttttgtttttggggaatggatgtttgttttctgc |
4428648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 186 - 299
Target Start/End: Complemental strand, 4439989 - 4439876
Alignment:
| Q |
186 |
gatgctttaagaatttatgtgttcaggcttgatgaaaaggagaagaaatggg-tgagtttgacaagtttgggggatagggttttgtttttggggaatgga |
284 |
Q |
| |
|
|||| |||||| ||| ||||||| ||| ||||||| |||||| ||||||| ||| ||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4439989 |
gatgttttaaggattaatgtgtttaggtttgatgagaaggagtgtaaatgggctga-tttgatgagtttgggagatagggttttgtttttggggaatgga |
4439891 |
T |
 |
| Q |
285 |
tgttcgttctctgct |
299 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
4439890 |
tgttcgttttctgct |
4439876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 299
Target Start/End: Complemental strand, 18991260 - 18991220
Alignment:
| Q |
259 |
atagggttttgtttttggggaatggatgttcgttctctgct |
299 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
18991260 |
atagggttttgttcttggggaatggatgttcgttttctgct |
18991220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 217 - 297
Target Start/End: Complemental strand, 7041594 - 7041514
Alignment:
| Q |
217 |
atgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgttctctg |
297 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||| ||||| ||||||||||||||||| ||||| | | |||||||||||||| |
|
|
| T |
7041594 |
atgagaaggagaagaagtgggtgaagttgactagtttaggggatagggttttgttcttgggagaagtatgttcgttctctg |
7041514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 7012951 - 7012857
Alignment:
| Q |
184 |
aagatgctttaagaatttatgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
||||| || |||||||| || |||| | |||| |||| ||||||||||| ||||||| ||||||||||| || |||||| ||||||| |||||| |
|
|
| T |
7012951 |
aagatcctgtaagaattgatttgtttaagcttaatgagaaggagaagaagtgggtgaagttgacaagtttaggagataggattttgttcttgggg |
7012857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 7029916 - 7029850
Alignment:
| Q |
212 |
gcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7029916 |
gcttaatgagaaggagaagaagtgggtgaagttgacgagtttcggggatagggttttgttcttgggg |
7029850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 7025859 - 7025793
Alignment:
| Q |
212 |
gcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| ||||| ||||| || |||||||||||||| |||||| |
|
|
| T |
7025859 |
gcttaatgagaaggagaagaagtgggtgaagttgacgagtttaggagatagggttttgttcttgggg |
7025793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 9170920 - 9170854
Alignment:
| Q |
212 |
gcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| || || ||||| ||||||||||||||||| |||||| |
|
|
| T |
9170920 |
gcttaatgagaaggagaagaagtgggtgaaattaacgagtttaggggatagggttttgttcttgggg |
9170854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 9159518 - 9159574
Alignment:
| Q |
222 |
aaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttgggg |
278 |
Q |
| |
|
||||||||||| ||||||| || || ||||| ||||||||||||||||| |||||| |
|
|
| T |
9159518 |
aaggagaagaagtgggtgaaattaacgagtttaggggatagggttttgttcttgggg |
9159574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 13170687 - 13170723
Alignment:
| Q |
202 |
atgtgttcaggcttgatgaaaaggagaagaaatgggt |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13170687 |
atgtgttcagacttgatgaaaaggagaagaaatgggt |
13170723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University