View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15636_high_5 (Length: 360)
Name: NF15636_high_5
Description: NF15636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15636_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 30 - 341
Target Start/End: Original strand, 13133500 - 13133820
Alignment:
| Q |
30 |
ctaagctcatggtgcattctctaataatgatcttgttccttggaatctcaaaattatctttagtttctcatatatttatttatatagaaggtaattcttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13133500 |
ctaagctcatggtgcattctctaataatgatcttgttccttggaatctcaaaattatctttagtttctcatatatttatttatatagaaggtaattcttg |
13133599 |
T |
 |
| Q |
130 |
tgcatatagtcctgcctattttagtattgtttctcgttgctatacttgctgagataatgttccctatgaccgtaatgaatgtgg-tttgtatgctttgag |
228 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13133600 |
tacatatagtcctgcctattttagtattgtttctcgttgctatacttgctgagataatgttccctatgaccgtaatgaatgtggttttgtatgctttgag |
13133699 |
T |
 |
| Q |
229 |
gtgtaa--------gttttaatgagttttggttcttgtccctcatgacacctctttatttttcatcgttttttaatnnnnnnnntttggtggtcgttgtt |
320 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13133700 |
gtgtaagtaacattgttttaatgagttttggttcttgtccctcatgacacctctttatttttcatcgttttttaataaaaaaaatttggtggtcgttgtt |
13133799 |
T |
 |
| Q |
321 |
gtcttcttgattgatgatgtc |
341 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
13133800 |
gtcttcttgattgatggtgtc |
13133820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University