View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15639_high_1 (Length: 502)
Name: NF15639_high_1
Description: NF15639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15639_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 30 - 462
Target Start/End: Complemental strand, 40647051 - 40646619
Alignment:
| Q |
30 |
gtaaacaaggtagatatgttcaccggagatcgaaacgccgaggagtttcacgatgctgacgtggtggctgcgacagatggtggaaagaagctcttgcagc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40647051 |
gtaaacaaggtagatatgttcaccggagatcgaaacgccgaggagtttcacgatgctgacgtggtggctgcgacagatggtggaaagaagctcttgcagc |
40646952 |
T |
|
| Q |
130 |
tgttgggtttggagtttgcgacggaatttgcgttggaagatgatgacgtcagagttacgcaaggtgcaacgccaacatggtgttgaggaagagtagcgtt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40646951 |
tgttgggtttggagtttgcgacggaatttgcgttggaagatgatgacgtcagagttacgtaaggtgcaacgccagcatggtgttgaggaagagtagcgtt |
40646852 |
T |
|
| Q |
230 |
tggagaggaagttgtttgtggcggaacagatttcggagaagtcgtagatgtttgggttttctgggagtgagttgcgaagagaggttaaggatgttctgct |
329 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40646851 |
tggagaggaagttatttgtggcggaacagatttcggagaagtcgtagatgtttgggttttctgggagtgagttgcgaagagaggttaaggatgttctgct |
40646752 |
T |
|
| Q |
330 |
tgagattgatgtatcggttgagagatggaatccggttgaaccggcgtatgaggttgaagggttgtcggaaaatgatgatgtttttgttttggtggttgca |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40646751 |
tgagattgatgtatcggttgagagatggaatccggttgaaccggcgtatgaggttgaagggttgtcggaaaatgatgatgtttttgttttggtggttgca |
40646652 |
T |
|
| Q |
430 |
cgtgtgattgtggtacttgcacgtgtgggttta |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40646651 |
cgtgtgattgtggtacttgcacgtgtgggttta |
40646619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University