View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15639_high_2 (Length: 473)
Name: NF15639_high_2
Description: NF15639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15639_high_2 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 154; Significance: 2e-81; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 273 - 442
Target Start/End: Original strand, 28634 - 28803
Alignment:
| Q |
273 |
tcttctcttctgacagaagcaactctgtagggaggagagcctgccgatcgagcgaaaggatccatacggctttcagggggagctgcttttacagcctact |
372 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28634 |
tcttctcttcgaacagaagcaactctgtagggaggagagcctgccgatcgagcgaagggatccatacggctttcagggggagctgcttttacagcctact |
28733 |
T |
|
| Q |
373 |
ggtatttaagtaacggacgtgtttaattaattttcacgatgattcattcaattcgttcgccgggaagtgc |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28734 |
ggtatttaagtaacggacgtgtttaattaattttcatgatgattcattcaattcgttcgccgggaagtgc |
28803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 126; Significance: 9e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 77 - 273
Target Start/End: Original strand, 6101423 - 6101620
Alignment:
| Q |
77 |
ttccccaaccaattcggtcgataaaatgagaggtatatcttccttatgtcgtttcatttgtttgacagtt-acttatgtcataactgtcatcgaggtatt |
175 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
6101423 |
ttccctaaccaattcggtcgataaagtgagagttatatcttccttatgtcatttcatttgtttgacaattcacttatgtcataactgtcattgaggtatt |
6101522 |
T |
|
| Q |
176 |
cagaccatccgcggtctctctcaattcttgtagttcttctagccaatcatgaacttttggtttgcgcttttttcgcagcaactgttttataatataat |
273 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
6101523 |
cagaccatatgtggtttctctcaattcttgtagttcttctagctaatcataaacttttggtttgcgcttttttccctgcagttgttttataatataat |
6101620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University