View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1563_high_19 (Length: 246)
Name: NF1563_high_19
Description: NF1563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1563_high_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 44506510 - 44506746
Alignment:
| Q |
10 |
atgaatcacgaagttgtcccgaatgatttgtagtcaataaatatctcatttgatgggaaaaatgagtagatagactaaaacagacctcacttatggatat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44506510 |
atgaatcacgaagttgtcccgaatgatttgtagtcaataaatatcttatttgacgggaaaaatgagtagatagactaaaacagacctcacttatggatat |
44506609 |
T |
 |
| Q |
110 |
tttttgtaggtcgtaatgctcttgtgagttatgtatcatattatcatttgaagaataacgctatgttttatgaaagtacaaattattaaatgcaccaaca |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| || |||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
44506610 |
tttttgtaggtcgtaatgctctcgtgagttatatatcatattatcatttgaagaatagcgatatgttttatgaaagtccaaattactaaatgcaccaaca |
44506709 |
T |
 |
| Q |
210 |
nnnnnnnnnggtgcaaatgcactaacgtcttttttct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44506710 |
tctttttttggtgcaaatgcactaacgtcttttttct |
44506746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University