View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1563_high_23 (Length: 203)
Name: NF1563_high_23
Description: NF1563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1563_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 4345976 - 4346151
Alignment:
| Q |
13 |
gagatgaaatcgaattaacacgccgccttcccgtcatgattacatgaaagtactttgagttggcatcacaatcttgtaaccataataaccgcgactgttg |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4345976 |
gagatgaaatcgaattaacacgccaccttcccgtcatgactacatgaaagtactttgagttgacatcacaatcttgtaaccataataaccgcgactgttg |
4346075 |
T |
 |
| Q |
113 |
ccgagagatactagaggacaaccgagataaagaatgcatatcaagagtattacttcgcaaatcatatagttcctcc |
188 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4346076 |
gcaagagatactagaggacaaccgagataaagaatgcatatcaagagtattacttcgcaaatcatatagttcctcc |
4346151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University