View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1563_low_21 (Length: 237)
Name: NF1563_low_21
Description: NF1563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1563_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 33168959 - 33169182
Alignment:
| Q |
18 |
agaatgggatcaggcggtggtggagcaccataaacaccaccac----gttgttattattgttgttgtcgtcgtcaccaccgccgctgtcgtaatgtggtg |
113 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||| |||||| ||||| |||||| ||||||| || |||||| || ||||| |||||| |
|
|
| T |
33168959 |
agaataggatcaggtggtggtggagcaccataaacaccaccaccgttgttgttgttattattgttgccgtcgtcgccgccgccgttgccgtaaggtggtg |
33169058 |
T |
 |
| Q |
114 |
ttggattataagggtaattgttattaccggatggtggtggatatggcaatccagattgtggtggtgctggtggagctgttgaaactgaaggagttggatt |
213 |
Q |
| |
|
| || ||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33169059 |
tagggttataagggtaattgttattaccagaaggtggtggatatggtaatccagattgtggtggtgctggtggagctgttgaaactgaaggagttggatt |
33169158 |
T |
 |
| Q |
214 |
tgtaggagtgacggttacacttcc |
237 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
33169159 |
tgtaggagtgacggttccacttcc |
33169182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 24 - 198
Target Start/End: Original strand, 44006801 - 44006976
Alignment:
| Q |
24 |
ggatcaggcggtggtggagcaccataaacaccaccac-gttgttattattgttgttgtcgtcgtcaccaccgccgctgtcgtaatgtggtgttggattat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
44006801 |
ggatcaggcggtggtggagcaccataaacaccaccaccgttgttattattgttgttgccgtcgtcaccgccgccgctgccgtaaggtggtgttggattat |
44006900 |
T |
 |
| Q |
123 |
aagggtaattgttattaccggatggtggtggatatggcaatccagattgtggtggtgctggtggagctgttgaaac |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44006901 |
aagggtaattgttattacaagatggtggtggatatggtaattcagattgtggtggtgctggtggagctgttgaaac |
44006976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 170
Target Start/End: Complemental strand, 19802825 - 19802675
Alignment:
| Q |
18 |
agaatgggatcaggcggtggtggagcaccataaacaccaccac----gttgttattattgttgttgtcgtcgtcaccaccgccgctgtcgtaatgtggtg |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||| ||||||||| ||||| |||||| |
|
|
| T |
19802825 |
agaataggatcaggcggtggtggagcaccataaacaccaccaccaccgttgttattattgt------catcgtcaccgccgccgctgccgtaaggtggtg |
19802732 |
T |
 |
| Q |
114 |
ttggattataagggtaattgttattaccggatggtggtggatatggcaatccagatt |
170 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19802731 |
ttggattataagagtaattgttattaccggatggtggtggatatggaaatccagatt |
19802675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University