View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_14 (Length: 496)
Name: NF15642_high_14
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 175 - 496
Target Start/End: Complemental strand, 31485470 - 31485157
Alignment:
| Q |
175 |
gtgatgtagaagtataaattggaggagtacaaagaagggaggaatctgcttgatagatgtgataaattgttgaacagcatagccgagataacagccgcga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31485470 |
gtgatgtagaagtataaattggaggagtacaaagaagggaggaatctgcttgatagatgtgataaattgttgaacagcatagctgagataacagccgcga |
31485371 |
T |
|
| Q |
275 |
acgagttacaaccgagtccagtatcggttcttgactcgtctttttacaaggacgaatggtgctcaccttcaccaattaccaaacgatgcattgattacaa |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31485370 |
acgagttacaaccgagtccagtatcggttcttgactcgtctttttacaaggacgagtggtgctcaccttcaccaattaccaaacgatgcattgattacaa |
31485271 |
T |
|
| Q |
375 |
tttcaaaggtgagactctattgctaaatgtgtagcctcnnnnnnncctgtcctatttctcttggaaaatccaacacctatgtggaccaatcattttgaca |
474 |
Q |
| |
|
||||||||| |||||| |||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31485270 |
tttcaaagg--------tattgcaaaatgtgtagcctctttttttcttgtcctatttctcttggaaaatccaaaacctatgtggaccaatcattttgaca |
31485179 |
T |
|
| Q |
475 |
tcagggttaaggacttagcatc |
496 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
31485178 |
tcagggttaaggacttggcatc |
31485157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 282 - 329
Target Start/End: Original strand, 38447467 - 38447514
Alignment:
| Q |
282 |
acaaccgagtccagtatcggttcttgactcgtctttttacaaggacga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
38447467 |
acaaccgagtccagtatcggttcttgactcctcgttttacaaagacga |
38447514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University