View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_25 (Length: 331)
Name: NF15642_high_25
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 31484633 - 31484963
Alignment:
| Q |
1 |
tgccttccacggtggtaacctttgattccggttaagaatttcctgcagcgtgtcgaaaattaaccgcctctgcagagtcggagcttttgaagtatccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31484633 |
tgccttccacggtggtaacctttgattccggttaagaatttcctgcagcgtgtcgaaaattaaccgcctctgcagagtcggagcttttgaagtatccttc |
31484732 |
T |
 |
| Q |
101 |
cccttacgaaattgttgcttctcaagtaggaggaaaatgtcgcattcttcaggcaagtaactagaagctcgcagaatctccgacacataaacaaaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31484733 |
cccttacgaaattgttgcttctcaagtaggaggaaaatgtcgcattcttcaggcaagtaactagaagctcgcagaatctccgacacataaacaaaatcac |
31484832 |
T |
 |
| Q |
201 |
aatcctccgattttgcctcctcctccgattttccttctcctgcactccacatatcatcttctgattccgtagattgatctgcaatgttacaatttcaacc |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31484833 |
aatcctccgattttgcctcctcctcggattttccttctcctgcactccacatatcatcttctgattccgtagattgatctgcaatgttacaatttcaacc |
31484932 |
T |
 |
| Q |
301 |
ataatcagcaactaaaacacacatatatatt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31484933 |
ataatcagcaactaaaacacacatatatatt |
31484963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University