View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_30 (Length: 307)
Name: NF15642_high_30
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 6970557 - 6970281
Alignment:
| Q |
19 |
ctcctaacaatccacggcgacctaaaagatcgaccatgcacgcataatgttcaacatcgggagaaatcccgaaagtcaaattcataatttcaaagtaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6970557 |
ctcctaacaatccacggcgacctaaaagatcgaccatgcacgcataatgttcaacatcgggagaaatcccgaaagtcaaattcataatttcaaagtaatg |
6970458 |
T |
 |
| Q |
119 |
ttgtcccatgtccacaagaccactgtgactgcaagcagaaagcaaccctgtaaacgtaatctcatcaggacaaactccacttgcctgcatcttctcaaac |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6970457 |
ttgtcccgtgtccacaagaccactgtgactgcaagcagaaagcaaccctgtaaacgtaatctcatcaggacaaactccacttgcctgcatcttctcaaac |
6970358 |
T |
 |
| Q |
219 |
atctcaatagcttcttttccataaccatgcagagcaagtgccccgataataacattccatgacactgcattcatctc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6970357 |
atctcaatagcttcttttccataaccatgcagagcaagtgccccgataataacattccatgacactgcattcttctc |
6970281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University