View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_37 (Length: 271)
Name: NF15642_high_37
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 32 - 260
Target Start/End: Complemental strand, 18783992 - 18783764
Alignment:
| Q |
32 |
aattatgaattgcgtccgatgtcagtgtttgccttaatgcttaataggtatttatttatgaatttatgcatctcgattcacaatcacgttactaaagtca |
131 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18783992 |
aattatgaattgtgtccgatgtcagtgtttgccttaatgcttaataggtatttatttatgaatttatgcatctcgattcacaatcacgttactaaagtca |
18783893 |
T |
|
| Q |
132 |
aaagggtttcattggattagatttttcattttcaagttaaactatagaagatcaaatctatagtctgttgataaataattaaatatggtgccaaaataac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18783892 |
aaagggtttcattggattagatttttcattttcatgttaaactatagaagatcaaatctatagtctattgataaataattaaatatggtgccaaaataac |
18783793 |
T |
|
| Q |
232 |
ctctcttagaattgaaaaatgaggttcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18783792 |
ctctcttagaattgaaaaatgaggttcat |
18783764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 231 - 260
Target Start/End: Complemental strand, 22872927 - 22872898
Alignment:
| Q |
231 |
cctctcttagaattgaaaaatgaggttcat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22872927 |
cctctcttagaattgaaaaatgaggttcat |
22872898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University