View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_44 (Length: 241)
Name: NF15642_high_44
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_44 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 110493 - 110698
Alignment:
| Q |
19 |
caagttgctatctgcgaatggaggaacgtataataaaatggctgaaattaagcgtgttaaagagaagatcacagtttgtgttaaccggtgaaattgcaga |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
110493 |
caagttgctatctgtgaatggaggaacgtataataaattggctgaaattaagcgtgttaaagagaagatcacagtttgtgttaaccggtgaaattgcaga |
110592 |
T |
 |
| Q |
119 |
gaatttaattttgatcgtgatatttgttgaaatgaaatcctgtgttcaattgataaagcaagatgcgatggaaatcattgtaagttttgaattattctcc |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
110593 |
gaatttaattttgaccgtgatatttgttgaaatgaaatcctgtgttcaattgataaagcaagatgcgatggaaatctttgtaagttttgaattattctcc |
110692 |
T |
 |
| Q |
219 |
ctttca |
224 |
Q |
| |
|
|||||| |
|
|
| T |
110693 |
ctttca |
110698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University