View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_high_46 (Length: 222)
Name: NF15642_high_46
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_high_46 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 222
Target Start/End: Original strand, 6970764 - 6970962
Alignment:
| Q |
24 |
aatatttggaaaatactggatcaaaatgggataaaaaagtgcagggcaattagcttcattgaaattgatggctgttgttatcaatttatggtggatgata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6970764 |
aatatttggaaaatactggatcaaaatgggataaaaaagtgcagggcaattagcttcattgaaattgatggctgttgttatcaatttatggtggatgata |
6970863 |
T |
 |
| Q |
124 |
aaacacatggagcttcaacaagtatatactctatgctgggtcaattaatggatcatctaaagtctgcggggtatccatgtaaacatttggatgtagagg |
222 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6970864 |
aaagacatggagcttcaacaagtatatactctatgctgggtcaattaatggatcatctaaagtctgcggggtatccatgtaaacatttggatgtagagg |
6970962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University