View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_low_36 (Length: 299)
Name: NF15642_low_36
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 25 - 284
Target Start/End: Complemental strand, 7497816 - 7497556
Alignment:
| Q |
25 |
gttgagatttttggttgaaaagctgtttaatatagtaga--taataaggagtggtcccttatcttaaggattttagtcctccannnnnnngttgtcttac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
7497816 |
gttgagatttttggttgaaaagctgtttaatatagtagagataataagaagtggtcccttattataaggattttagtcctccatttttt-gttgtcttac |
7497718 |
T |
|
| Q |
123 |
atgaagtggtaaagactatatgaannnnnnnnnnnnnnnnnnnnnnattgcacaactgtaaggtccttaattcgaattcaggtgaaggtgtctagcctca |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7497717 |
atgaagtggtaaagactatatgaaacacacacaactcacacacacaattgcacaactgtaaggtccttaattcgaactcaggtgaaggtgtctagcctca |
7497618 |
T |
|
| Q |
223 |
aaatagtgatcttagactttaaggactagtcctcataaggtcctgaattcgaactcatgtga |
284 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7497617 |
aaatagtgatcttagactttaaggactggtccttataagatcctgaattcgaactcatgtga |
7497556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 208 - 255
Target Start/End: Complemental strand, 7497547 - 7497500
Alignment:
| Q |
208 |
aggtgtctagcctcaaaatagtgatcttagactttaaggactagtcct |
255 |
Q |
| |
|
||||||||||||| | ||||||||||| || ||||||||||||||||| |
|
|
| T |
7497547 |
aggtgtctagcctaagaatagtgatctcaggctttaaggactagtcct |
7497500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University