View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_low_38 (Length: 282)
Name: NF15642_low_38
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 38774396 - 38774143
Alignment:
| Q |
18 |
cttccaccaacccaacagctccatctttgttttcttgttgaatttcaacttcatatcgaggtttccttggttttcgggtgttgttttgagtgagtctggt |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38774396 |
cttcaaccaacccaacagctccatctttgttttcttgttgaatttcaacttcatatcgaggtttccttggttttcgggtgttgttttgagtgagtctggt |
38774297 |
T |
|
| Q |
118 |
tttgccacgacgttttacaccggcgggttcaggtgattcatcagcggcagtttcaagacggtcgatgagacgggtcttggatttactgagaggggaaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38774296 |
tttgccacgacgttttacaccggcgggttcaggtgattcatcagcggcagtttcaagacggtcgatgagacgggtcttggattttctgagaggggaaggt |
38774197 |
T |
|
| Q |
218 |
gaaggagatggtgacggtgatggagattgttggattggattagcggtgatgatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38774196 |
gaaggagatggtgacggtgatggagattgttggattggattagcggtgatgatg |
38774143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University