View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_low_46 (Length: 250)
Name: NF15642_low_46
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 1104724 - 1104918
Alignment:
| Q |
1 |
tggatgcttccacagtaggtaaatgtgttatggttctttaatgtttatttattt-ggttatatttgtgtctgtttttgctaatccctacataaatattta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1104724 |
tggatgcttccacagtaggtaaatgtgttatggttctttaatgtttatttatttaggttatatttgtgtctgtttttcctaatccctacataaatattta |
1104823 |
T |
 |
| Q |
100 |
ggctgccaacaaattttcatagaattaattcatatgacatctttgaaaatatgtttttcatccgaataaataatctaaattactttcattatttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1104824 |
ggctgccaacaaattttcatagaattaattcatatgacatctttgaaataatgtttttcatccgaataaataatctaaattactttcattatttt |
1104918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University