View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_low_47 (Length: 249)
Name: NF15642_low_47
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 52 - 233
Target Start/End: Complemental strand, 42842561 - 42842380
Alignment:
| Q |
52 |
taaaggtgaaaatattcttgaaagtgcgtatttgaaaagcgctaannnnnnnnnnn-gagggaaaggcgctaattatttgaaaatacacatccaaacatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42842561 |
taaaggtgaaaatattcttgaaagtgcgtatttgtaaagcgctaattttttttttttgagggaaaggcactaattatttgaaaatacacatccaaacatg |
42842462 |
T |
 |
| Q |
151 |
taaatctgacggtctttcttttacatagtgcatgcttccaaaataatgctagaggtagggaaattactatcttagtactattt |
233 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42842461 |
taaatctgacggtctttc-tttacgtagtgcatgcttccaaaatgatgctagaggtagggaaagtactatcttagtactattt |
42842380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University