View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15642_low_54 (Length: 213)
Name: NF15642_low_54
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15642_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 14965951 - 14965768
Alignment:
| Q |
13 |
atgaaaactaaaaaatggattattttaaaaggctcatctaatcatagtaatatatgttaatcatggttttaaagtgcagtctgcaaccataattatggtc |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965951 |
atgaaaactaaaaaatggcttattttaaaaggctcatctaatcatagtaatatatgttaatcatggttttaaagtgcagtctgcaaccataattatggtc |
14965852 |
T |
|
| Q |
113 |
gtaatataaaggattttgatgtctctacaacgatataacagctgcaatataaaattttataggataccgaaaatgcaatgtaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14965851 |
ataatataaaggattttgatgtctctacaacgatataacagccacaatataaaattttgtaggataccgaaaatgcaatgtaaa |
14965768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 2705881 - 2705938
Alignment:
| Q |
79 |
ttttaaagtgcagtctgcaaccataattatggtcgtaatataaaggattttgatgtct |
136 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| || |||||| ||||||| |||| |
|
|
| T |
2705881 |
ttttaaagtgcagtctgcaaccctaactatggtcgcaacataaagaattttgaagtct |
2705938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University