View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15643_high_5 (Length: 219)
Name: NF15643_high_5
Description: NF15643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15643_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 32 - 133
Target Start/End: Original strand, 30973621 - 30973722
Alignment:
| Q |
32 |
ctctaaacaaatgatgttagctttgaagaagcataaggttgtttcaacatatactgtaagcatagcttttaaggagaattttggatggacaagttaatta |
131 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30973621 |
ctctaaacaaatgatgttagctgtgaagaagcataaggttgtttcaacatatactgtaagcatagcttttaaggataattttggatggacaagttaatta |
30973720 |
T |
 |
| Q |
132 |
ag |
133 |
Q |
| |
|
|| |
|
|
| T |
30973721 |
ag |
30973722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University