View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15644_high_18 (Length: 296)
Name: NF15644_high_18
Description: NF15644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15644_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 45466876 - 45467136
Alignment:
| Q |
1 |
tgttctggtcctaccaacgtcaagaaatcgaacacgtcaatgatttcaaaaaccatcaacttccattagcacgcattaagaaaatcatgaaagctgatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45466876 |
tgttctggtcctaccaacgtcaagaaatcgaacacgtcaatgacttcaaaaaccatcaacttccattagcacgcattaagaaaatcatgaaagctgatga |
45466975 |
T |
 |
| Q |
101 |
agacgttcgcatgatttctgcagaagcaccaattctctttgctaaagcttgtgagcttttcattcttgaactcaccattcgttcttggcttcatgctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45466976 |
agacgttcgcatgatttctgcagaagcaccaattctctttgctaaagcttgtgagcttttcattcttgaactcaccattcgttcttggcttcatgctgaa |
45467075 |
T |
 |
| Q |
201 |
gagaataaacgacgaactcttcagaaaaatgatattgctgctgctattactaggactgata |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467076 |
gagaataaacgacgaactcttcagaaaaatgatattgctgctgctattactaggactgata |
45467136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 46851686 - 46851644
Alignment:
| Q |
219 |
cttcagaaaaatgatattgctgctgctattactaggactgata |
261 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
46851686 |
cttcagaagaatgatattgctgctgcaatcactaggactgata |
46851644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University