View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15644_high_20 (Length: 253)
Name: NF15644_high_20
Description: NF15644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15644_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 6 - 167
Target Start/End: Original strand, 6207836 - 6207999
Alignment:
| Q |
6 |
aattggctagtgtttgatggagaataggttagtgttcaaagtgaaagattcatagattattacatgaataagaccatgtt------tttgagacactatg |
99 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
6207836 |
aattgactagtgtttgatggagaataggctagtgttcaaagtgaaagattcataggttattacatgaa---gaccatgtttttgtttttgagagactatg |
6207932 |
T |
 |
| Q |
100 |
tttcttccataaatgtggtcttctctatgtaattgtcttgttttttcactttgcaaccctagcacatc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
6207933 |
tttcttccataaatgtggtcttctctatgtaattgtcttg-tttttcactttgcatccctagcacatc |
6207999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University