View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15644_high_23 (Length: 246)
Name: NF15644_high_23
Description: NF15644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15644_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 42615891 - 42615768
Alignment:
| Q |
1 |
ttgaatgtgttgttttcgtttatcgggtgttaattcgatgataagagtttgatattaaaacttcaagcagccgagttcaaatttcatctagaatagttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42615891 |
ttgaatgtgttgttttcgtttatcgggtgttaattcgatgataagagtttgatattaaaacttcaagcagccgagttcaaatttcatctagaatagttgt |
42615792 |
T |
 |
| Q |
101 |
cagtatcactttaattaataataa |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42615791 |
cagtatcactttaattaataataa |
42615768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 155 - 243
Target Start/End: Complemental strand, 42615737 - 42615649
Alignment:
| Q |
155 |
aaatatattgttcctgtgattggagcttggaaggggagggtcatgatgtgggtaagagacaaaaggaattggcaaggaatattcttgga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42615737 |
aaatatattgttcctgtgattggagcttggaaggggagggtcatgatgtgggtaagagacaaaaggaattggcaaggaatatttttgga |
42615649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University