View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15644_low_23 (Length: 346)

Name: NF15644_low_23
Description: NF15644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15644_low_23
NF15644_low_23
[»] scaffold0141 (1 HSPs)
scaffold0141 (188-333)||(6184-6329)
[»] chr1 (3 HSPs)
chr1 (168-333)||(49237921-49238086)
chr1 (13-122)||(44285603-44285712)
chr1 (13-122)||(44070301-44070410)


Alignment Details
Target: scaffold0141 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: scaffold0141
Description:

Target: scaffold0141; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 188 - 333
Target Start/End: Complemental strand, 6329 - 6184
Alignment:
188 agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagatatca 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6329 agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagatatca 6230  T
288 aggctggtaccaaagcaaagagaagaataagaatctaatctctgct 333  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
6229 aggctggtaccaaagcaaagagaagaataagaatctaatctctgct 6184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 146; Significance: 7e-77; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 168 - 333
Target Start/End: Original strand, 49237921 - 49238086
Alignment:
168 cagactgcctctttctagatagattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgc 267  Q
    |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |    
49237921 cagactgcctatttctagatagattctatggatgatgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccaatgcatgtcgtac 49238020  T
268 cttgcaagattgagatatcaaggctggtaccaaagcaaagagaagaataagaatctaatctctgct 333  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49238021 cttgcaagattgagatatcaaggctggtaccaaagcaaagagaagaataagaatctaatctctgct 49238086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 44285712 - 44285603
Alignment:
13 gagaagaactagcgagaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaactt 112  Q
    ||||||||||||| |||||||| || || |||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||    
44285712 gagaagaactagcaagaaatgccgaatttgctccgcatcgttaggtaaagatccccattggccaatcttcctttaatggatatattcttcaatgtaactt 44285613  T
113 ccggtaagaa 122  Q
    ||||||||||    
44285612 ccggtaagaa 44285603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 44070301 - 44070410
Alignment:
13 gagaagaactagcgagaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaactt 112  Q
    ||||||||||||| |||||||| || |||||||||||   | ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||    
44070301 gagaagaactagcaagaaatgccgaattcgctccgcattgtaaggtaaagatctccattgtccaatcttgctttaatggatatattcttcaatgtaactt 44070400  T
113 ccggtaagaa 122  Q
    | ||||||||    
44070401 ctggtaagaa 44070410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University