View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15647_high_3 (Length: 446)
Name: NF15647_high_3
Description: NF15647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15647_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 44094445 - 44094065
Alignment:
| Q |
1 |
attatatattggtgtgtcacgttttgtttctttcctgtcttttattcttgctgtctacacccccatgttgtttgctttcaattttgaataccctctttct |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44094445 |
attatatattggtgtgtcatgttttgtttctttcctatcttttattcttgctgtctacacccccatgttgtttgctttcaattttgaataccctctttct |
44094346 |
T |
|
| Q |
101 |
tcattcttactgtttcttcgactatgtcgctcaagaggggtcccgatgataacaagactccagatgataaacgtagaaagcctcctccttttcccaggtc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44094345 |
tcattcttactgttacttcgactatgtcgctcaagaggggtcccgatgataacaagactccagatgataaacgtagaaagcctcctcctttttccaggtc |
44094246 |
T |
|
| Q |
201 |
agtgagtgtgtatgatctttttgtacttcatttatttacttttgatctttctgtttgattatgttttgaggaaatgggaatggtgaaaaggatgaatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44094245 |
agtgagtgtgtatgatctttttgtacttcatttatttacttttgatctttctgtttgattatgttttgaggaaatgggaatggtgaaaaggatgaatttt |
44094146 |
T |
|
| Q |
301 |
gatctgaaatcaaatggggtgtttttggttttgcaaatgtgaaattgtgaattgcatttttattaaattggggctcaaaat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44094145 |
gatctgaaatcaaatggggtgtttttggttttgcaaatgtgaaattgtgaattgcatttttattaaattggggctcaaaat |
44094065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University