View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15648_high_10 (Length: 237)
Name: NF15648_high_10
Description: NF15648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15648_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 19 - 157
Target Start/End: Original strand, 45447717 - 45447855
Alignment:
| Q |
19 |
ttgaagtataagaaaaagaaccatcaattgagggactaagatgacgaattttatatattttagggactattgttaaatggactccaaaagctagctcatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45447717 |
ttgaagtataagaaaaagaaccatcaattgagggactaagatgacgaattttatatattttagggactattgttaaatggactccaaaagctagctcatc |
45447816 |
T |
|
| Q |
119 |
aaatgagggagtccaagcactacttatatacaatgccta |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45447817 |
aaatgagggagtccaagcactacttatatacaatgccta |
45447855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 219
Target Start/End: Original strand, 45447851 - 45447894
Alignment:
| Q |
176 |
gcctaggttcgttttccacatgccctacaaaattcagatttgaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45447851 |
gcctaggttcgttttccacatgccctacaaaattcagatttgaa |
45447894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University