View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15648_high_6 (Length: 277)
Name: NF15648_high_6
Description: NF15648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15648_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 3137578 - 3137835
Alignment:
| Q |
1 |
catgtaagtggagcaagatccatagggtttggcataaagggagccacatggtcccctaaaatggacaatttgccaaccnnnnnnntacacatcccactga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3137578 |
catgtaagtggagcaagatccatagggtttggcataaagggagccacatggtcccctaaaatggacaatttgccaaccaaaaaaatacacatcccactga |
3137677 |
T |
 |
| Q |
101 |
tccacaccctaaccattatcaaattttgggaccattaatcaaagtcaccattatttatttttgatagtctttttcccacgcctaatttcaccccatgatt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137678 |
tccacactctaaccattatcaaattttgggacccttaatcaaagtcaccattatttatttttgatagtctttttcccacgcctaatttcaccccatgatt |
3137777 |
T |
 |
| Q |
201 |
aatttctcctaacccacacatgcacatatgattagacaaaaggttgttgccacctttt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137778 |
aatttctcctaacccacacatgcacatatgattagacaaaaggttgttgccacctttt |
3137835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University