View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15648_low_12 (Length: 231)
Name: NF15648_low_12
Description: NF15648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15648_low_12 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 6611533 - 6611716
Alignment:
| Q |
17 |
taaaatacaccagatcgcagaatgggccaagagctgctcgcaggtctgcggttactcacgcctatgtaggcagagggtagttcactatctagaccgagag |
116 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
6611533 |
taaaatacaccagaccgcagaacgggccaagagctgctcacaggtctggggttactcacgcctatgaaggccgagggtagttcactatctagaccgagag |
6611632 |
T |
|
| Q |
117 |
ttactcatgttcgcaccgaatgtatgattgtcaggataaggcttgacagtctagccctactaggacattttttatacccaggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6611633 |
ttactcatgttcgcaccgaatgtatgattgtcaggataaggcttgaccgtctagccctactaggacattttttatacccaggta |
6611716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 193
Target Start/End: Original strand, 215818 - 215901
Alignment:
| Q |
111 |
cgagagttactcatgttcgcacc-gaatgtatgattgtcaggataaggcttgacagtctagccctactaggacattttttatac |
193 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||||||| |||||| |||| || |||||| ||||| |||| | ||||||| |
|
|
| T |
215818 |
cgagagttactcatgtccgtacccgaatgtatgattgtcagaataaggtttgaaagcctagccatactaagacactatttatac |
215901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 193
Target Start/End: Complemental strand, 14601560 - 14601477
Alignment:
| Q |
111 |
cgagagttactcatgttcgcacc-gaatgtatgattgtcaggataaggcttgacagtctagccctactaggacattttttatac |
193 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||||||| |||||| |||| || |||||| ||||| |||| | ||||||| |
|
|
| T |
14601560 |
cgagagttactcatgtccgtacccgaatgtatgattgtcagaataaggtttgaaagcctagccatactaagacactatttatac |
14601477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University