View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15648_low_2 (Length: 408)
Name: NF15648_low_2
Description: NF15648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15648_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 18 - 374
Target Start/End: Complemental strand, 36084254 - 36083898
Alignment:
| Q |
18 |
gttagagataaggttcatgctcatctcggtcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaataaacaaacactgaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084254 |
gttagagataaggttcatgctcatctcggtcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaataaacaaacactgaattt |
36084155 |
T |
 |
| Q |
118 |
gagctagattgtttataatgttccattgtttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcagtaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36084154 |
gagctagattgtttataatgttccattgtttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcattaat |
36084055 |
T |
 |
| Q |
218 |
ctttgatattgtagaaaatcacggataaatacaacttgtgtttccgcaatagcgatcacaatttgatgtccgtgacaatataacgttgaaaacgctgcta |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | | |||| |
|
|
| T |
36084054 |
atttgatattgtagaaaattgcggataaatacaacttgtgtttccgcgatagcgatcacaatttgatgttggtgacaatataacgttgaaatcacggcta |
36083955 |
T |
 |
| Q |
318 |
tattttccgttgcagaccgttttttaaaaccttgaccaagatttaaggattagcttt |
374 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36083954 |
tatttgccgttgcagaccattttttaaaaccttgaccaagatttaaggactagcttt |
36083898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University