View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15649_high_4 (Length: 341)
Name: NF15649_high_4
Description: NF15649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15649_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 44 - 324
Target Start/End: Original strand, 13160081 - 13160362
Alignment:
| Q |
44 |
ataaactttataccattttgatgataaaagnnnnnnnnctattgatatgatcatatacnnnnnnnn-aagaaattacgatcatatacttaattaactgtt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
13160081 |
ataaactttataccattttgatgataaaagaaaaaaaactattgatatgatcatatgctttttttttaagaaattacgatcatatacttaattaactgtt |
13160180 |
T |
|
| Q |
143 |
ttttatcgtatcagatgctcaaataggaatatgttatggtatgatgggaaacaatctaccaccggcaaacgaggttataaatctctacaaagcaaacaac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160181 |
ttttatcgtatcagatgctcaaataggaatatgttatggtatgatgggaaacaatctaccaccggcaaacgaggttataaatctctacaaagcaaacaac |
13160280 |
T |
|
| Q |
243 |
attaagagaatgagactctacgatcctaatcaagctgctctaaatgcattaagaaattcaggcattgaactcattcttggtg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160281 |
attaagagaatgagactctacgatcctaatcaagctgctctaaatgcattaagaaattcaggcattgaactcattcttggtg |
13160362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University