View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15649_low_12 (Length: 236)
Name: NF15649_low_12
Description: NF15649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15649_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 54895855 - 54895657
Alignment:
| Q |
23 |
atcgtcaagtgttagttgttagtgattagtgagtgattattttagtttctagggtttcaacaatcacttcttggttataagcaagctataagaatgtttg |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895855 |
atcggcaagtgttagttgttagtgattagtgagtgactattttagtttctagggtttcaacaatgacttcttggttataagcaagctataagaatgtttg |
54895756 |
T |
 |
| Q |
123 |
gactccgacatgtgttaattagtatcaggcacaactcattcaatcacttacattttctcaaattattataagtgtgatgtgtgtaggttataaatttat |
221 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54895755 |
gactccgacatgtgttaattagtatcgggcacaactcattcaatcacttacattttctcaaattattataagtgtgatgtgtataggttataaatttat |
54895657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 197
Target Start/End: Original strand, 34399917 - 34399955
Alignment:
| Q |
159 |
cattcaatcacttacattttctcaaattattataagtgt |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
34399917 |
cattcaatcatttacattttctcaaattattatcagtgt |
34399955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University