View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15649_low_13 (Length: 234)
Name: NF15649_low_13
Description: NF15649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15649_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 9677930 - 9678143
Alignment:
| Q |
15 |
atgaagaaattggtgaaccggtgaaaatggttgaaccggctaatg------aagatgaacctgttgaagtagaaccgtttggtgagtgtgaaggtgaaac |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9677930 |
atgaggaaattggtgaaccggtgaaaatagttgaaccggttaatgaaaatgaagatgaaccggttgaagtagaaccgtttggtgagtgtgaaggtgaaac |
9678029 |
T |
 |
| Q |
109 |
gaggtttttcgacgaaactaatgatattttccgacaagacatggttgaagtgttcaattatccaacaacatgtgattattcacttatgtttgatgaagat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9678030 |
gaggtttttcgacgaaactaatgatattttccgacaagacatggatgaagtgttcaattttcctacaacatgtgattattcacttatgtttgatgaagat |
9678129 |
T |
 |
| Q |
209 |
cctatgttattttt |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9678130 |
cctatgttattttt |
9678143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University