View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15649_low_4 (Length: 463)
Name: NF15649_low_4
Description: NF15649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15649_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 11 - 447
Target Start/End: Complemental strand, 50047831 - 50047395
Alignment:
| Q |
11 |
cataggttacgctatttgcagtgcacttcacaggctgcgtgtatttttggttggctttccatcacaaatcacccggaaacacgtggattgggaagcaggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047831 |
cataggttacgctatttgcagtgcacttcacaggctgcgtgtatttttggttggctttccatcacaaatcacccggaaacacgtggattgggaagcaggt |
50047732 |
T |
|
| Q |
111 |
agaggattttaagcataggagtgtcggatcgggttacacttactccatgtattggtctattgtaacccttaccactgttggctatggagatttacatgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047731 |
agaggattttaagcataggagtgtcggatcgggttacacttactccatgtattggtctattgtaacccttaccactgttggctatggagatttacatgca |
50047632 |
T |
|
| Q |
211 |
gaaaatacaacggagaaggttttcaatattttttatatgctgtttaacatcggactcactgcatatattatcggaaacatgacaaatctggtggttcata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047631 |
gaaaatacaacggagaaggttttcaatattttttatatgctgtttaacatcggactcactgcatatattatcggaaacatgacaaatctggtggttcata |
50047532 |
T |
|
| Q |
311 |
gctctgtccgaacctttgctatggtaaattttatgaagatttttcatggtagtttaacccttgacttagcattgaattctataacactaacatcaacata |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047531 |
gctctgtccgaacctttgctatggtaaattttatgaagatttttcatggtagtttaacccttgacttagcattgaattctataacactaacatcaacata |
50047432 |
T |
|
| Q |
411 |
gttttatgtcttcctagtggaagttaaaggaagaaaa |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047431 |
gttttatgtcttcctagtggaagttaaaggaagaaaa |
50047395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University