View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15651_low_1 (Length: 546)
Name: NF15651_low_1
Description: NF15651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15651_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 137 - 529
Target Start/End: Complemental strand, 4609142 - 4608750
Alignment:
| Q |
137 |
tagcctctgaagaaagtttgaatctttacagcagcccatttctctctacttccactgaacaatgtacctctaccttgacttgtcaacctcacaactgcca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4609142 |
tagcctctgaagaaagtttgaatctttacagcagcccatttctctctacttccactgaacaatgtacctctaccttgacttgtcagcctcacaactgcca |
4609043 |
T |
|
| Q |
237 |
cggcagcctgcgcggcggccacagcagcatccgcagcggccgccgtagcagctgcaacagcaattgcatgtttgttctgttgattttctgtatcagcaat |
336 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609042 |
cggcagcctgtgcggcggccacagcagcatcagcagcggccgccgtagcagctgcaacagcaattgcatgtttgttctgttgattttctgtatcagcaat |
4608943 |
T |
|
| Q |
337 |
ataggatctgagccaagaaccatcagaagatgaagtaggagtaatgttaggaggttccacttcaacattcttcccttgttttgcaaaactccatcttctc |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608942 |
ataggatctgagccaagaaccatcagaagatgaagtaggagtaatgttaggaggttccacttcaacattcttcccttgttttgcaaaactccatcttctc |
4608843 |
T |
|
| Q |
437 |
ttctcctttttgatgtcaggtgtcaatgaacctgaattaatgtcactgtggtccttctctttctccttcttcttgtttcctaacaaactctta |
529 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608842 |
ttctcctttttgatgtcaggtgtcaatgaacctgaattgatgtcactgtggtccttctctttctccttcttcttgtttcctaacaaactctta |
4608750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University