View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_high_14 (Length: 481)
Name: NF15655_high_14
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 18 - 466
Target Start/End: Original strand, 3713186 - 3713630
Alignment:
| Q |
18 |
cacagaggatgaggagcagaagaagaggaagtgaagccatgttgagataaaatgcagaacaagaataaagactcaatgtttgtatgaatgtctaggttca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713186 |
cacagaggatgaggagcagaagaagaggaagagaagccatgttgagataaaatgcagaacaataataaagactcaatgtttgtatgaatgtctaggttca |
3713285 |
T |
 |
| Q |
118 |
gttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713286 |
gttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaac |
3713385 |
T |
 |
| Q |
218 |
cttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagggacatctcattgaccatccct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713386 |
cttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagggacatctcattgaccatccct |
3713485 |
T |
 |
| Q |
318 |
accataagggatatactataactgaaccaactgatacggaattaagattttcagcaaattagcatcaagtatatatgatctgcaaaattcatctgtctcc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3713486 |
accataagggatatactataactgaaccaactgatagggaattaagattttcagcaaattagcatcaag----tatgatctgcaaaattcatctgtctcc |
3713581 |
T |
 |
| Q |
418 |
aaaattgtagttgttcgatgtctttatttaccgaccaggctacttagtg |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713582 |
aaaattgtagttgttcgatgtctttatttaccgaccaggctacttagtg |
3713630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University