View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_high_20 (Length: 393)
Name: NF15655_high_20
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 3161723 - 3162063
Alignment:
| Q |
1 |
tccttctatatcatccaatattgatggagatctctcgctgtggaattcatttgatctttctaatattggctttgttacctactaattaaaaatttcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3161723 |
tccttctatatcatccaatattgatggagatctctcactgtggaattcatttgatctttctaatattggctttgttacctactaattaaaaatttcatta |
3161822 |
T |
 |
| Q |
101 |
aattaggattttaactttataatgtatgctaaaacatactgtgagttgtgacgatatatttttatccaattttgttattctagtaattaaggtgtagttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3161823 |
aattaggattttaactttataatgtatgctaaaacatactgtgagttgtgacaatatatttttatccaattttgttattctagtaattaaggtgtagttc |
3161922 |
T |
 |
| Q |
201 |
atgatatttccttagttcattaatgccagttcttgaacaggcatgaaacaaaacccgtacttgcggatatccgctcgaacccatcctgatttgatggact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||| ||||||| ||||| |
|
|
| T |
3161923 |
atgatatttccttagttcattaatgccagttcttgaacaggcatgaaacaaaactcgtacttgcggatatccgctcaaatccatcccgatttgacggact |
3162022 |
T |
 |
| Q |
301 |
ttctccgttttggtagagtttgagttttcccaatttcaaac |
341 |
Q |
| |
|
||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
3162023 |
ttccccgttttggtagagtttgaattttcccgatttcaaac |
3162063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University