View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_high_31 (Length: 316)
Name: NF15655_high_31
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 50 - 306
Target Start/End: Complemental strand, 22647109 - 22646853
Alignment:
| Q |
50 |
ggtttgatgatggtcctttatgtgttaggtttagatggnnnnnnnagttgtctaaaaatattttggtattaattgttgagatgtgtaatttagggaggga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22647109 |
ggtttgatgatggtcctttatgtgttaggtttagatggtttttttagttgtctaaaaatattttggtattaattgttgagatgtgtaatttagggaggga |
22647010 |
T |
|
| Q |
150 |
tgttgatggttggaagtggcagatgagcaaggtggtggtgtattgtgatttgttataaaacattttttgcaggttgatgtgcaaataaatgagattggaa |
249 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22647009 |
tattgatggttggaagtggcagatgagcaaggtggtggagtattgtgatttgttataaaacattttttgcaggttgatgtgcaaataaatgagattggaa |
22646910 |
T |
|
| Q |
250 |
gctcgatcctgatcaaggctatacatttagtcgatgtctcctttgaaggtccctatg |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22646909 |
gctcgatcctgatgaaggctatacatttagttgatgtctcctttgaaggtccctatg |
22646853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 22647545 - 22647489
Alignment:
| Q |
1 |
gtggtgggtaatggggtcattttgcttttctagtttgatctttggttttggtttgat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22647545 |
gtggtgggtaatggggtcattttgcttttctagtttgatctttggttttggtttgat |
22647489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University