View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_high_36 (Length: 278)
Name: NF15655_high_36
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 52379485 - 52379733
Alignment:
| Q |
17 |
aattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379485 |
aattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatcat |
52379584 |
T |
|
| Q |
117 |
gctcaattcgtatgagatcttccttgaggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379585 |
gctcaattcgtatgagatcttccttgaggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgatt |
52379684 |
T |
|
| Q |
217 |
tggatcttctggaccatatactgcaagtgcatcctcaaaacgtctgttc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379685 |
tggatcttctggaccatatactgcaagtgcatcctcaaaacgtctgttc |
52379733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University