View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_high_42 (Length: 256)
Name: NF15655_high_42
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 22646871 - 22646635
Alignment:
| Q |
1 |
tcctttgaaggtccctatgtttctgagacgtttgttaagtaacataatttttatgagggataatttcgttaggcgcatagttcttctattagannnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||| |||||||||| |
|
|
| T |
22646871 |
tcctttgaaggtccctatgtttgtgagacgtttgttaagtaacataatttctatgaaggataatttcattaggcgcatagtttttctattagattttttt |
22646772 |
T |
 |
| Q |
101 |
nnnnnnnnnnngtgaggggttgtggtgtggagaaaaatgttgatcatatttttatgagtagtgatttttctgatagtttttggtctcttattttgcaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
22646771 |
tt---------gtgaggggttgtggtgtggagaaaaatgttgatcatctttttatgagtagtgatttttctggtagtttttgatctcttattttgcaata |
22646681 |
T |
 |
| Q |
201 |
gttaggaattaattcaacacttttgttggatctctccgaccctttg |
246 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22646680 |
gtcaggaattaattcaacacttttgttggatctctccgaccctttg |
22646635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University