View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_low_31 (Length: 333)
Name: NF15655_low_31
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 40679784 - 40679636
Alignment:
| Q |
23 |
cccttttaaaacctgatatccgatcaaatgattgattaatttgagaagatcaatccgataattcattagcggagagcccgttcaaaattaatatagataa |
122 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40679784 |
cccttttaaaaccttatatccgatcaaatgattgattaatttgaggagatcaatccgataatccattagcggagagtccgttcaaaattaatatagataa |
40679685 |
T |
 |
| Q |
123 |
gactaaagaaattggcataaagagaatttgaacataggctcttagtaga |
171 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40679684 |
gactaaagaaattagcataaagagaatttgaacatagtctcttagtaga |
40679636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University