View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_low_37 (Length: 284)
Name: NF15655_low_37
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 41079633 - 41079875
Alignment:
| Q |
11 |
caaaggttgtaatcttgctaccgtgtgcgacgtggagggaaccgtaaggggtggttgagacggtggaaggagagtctcttccgtttaagggtaattgaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079633 |
caaaggttgtaatcttgctaccgtgtgcgacgtggagggaaccgtaaggggtggtagagacggtggaaggagagtctcttccgtttaagggtaattgaag |
41079732 |
T |
 |
| Q |
111 |
tgagttttgaagattgaaaggttcaaattgagaagggttagagagagaattgattaagagattttcgatgccgtagaatttggattcaatgataaggtct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079733 |
tgagttttgaagattgaaaggttcaaattgagaagggttagagagagaattgattaagagattttcgatgccgtagaatttggattcaatgataaggtct |
41079832 |
T |
 |
| Q |
211 |
tgaagatcgaatgattttgcttttgaaggaagattaccggtgc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079833 |
tgaagatcgaatgattttgcttttgaaggaagattaccggtgc |
41079875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University