View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_low_51 (Length: 216)
Name: NF15655_low_51
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 3276456 - 3276255
Alignment:
| Q |
1 |
aattctagccactaggctacctgacnnnnnnnnnnnntgaaggaagacatcaccggcaaaccggatgagatagccaaccataccatatgaaaatcttata |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |||| ||| ||||||||||||| |
|
|
| T |
3276456 |
aattctagccactaggctacctgaccaaaaaaaaaaatgaaggaagacatcctcggcaaaccggatgagatacccaatcatatcatttgaaaatcttata |
3276357 |
T |
|
| Q |
101 |
ccaaatatcacttccaaaaacacatgtaacaaaaagatgatcttccattatatgcttccccggacaccaaatacaatccgatttccttgtatataaatta |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3276356 |
ccaaatattacttccaaaaacacatgtaacaaaaagatgatcttccattatatgcttcccctgacaccaaatacaatccgatttccttgtatataaatta |
3276257 |
T |
|
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
3276256 |
ct |
3276255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University