View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15655_low_9 (Length: 572)
Name: NF15655_low_9
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15655_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 45645504 - 45645766
Alignment:
| Q |
19 |
gcctcttgctccagatgtggtacccctcaagagtctattc----ttcattgtcttggaaatattgttgagctcaaacacctttcttaaaacctgtcttat |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45645504 |
gcctcttgctccagatgtggtgcccctcaagagtctattcgatcttcattgtcttggaaatattgttgagttcaaacacctttcttaaaacctgtcttat |
45645603 |
T |
 |
| Q |
115 |
tctcatactctgtgtgaaggcaactctagtgcaaactgattagccaaattggatgcatggacatttcttaggcttgtg-----tcatgtattcatctctt |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
45645604 |
tctcatactctgcgtgaaggcaactctagtgcaaactgattagccaaattggatgcatggacatttcttaggcttgtgttgtatcatgtattcgtctctt |
45645703 |
T |
 |
| Q |
210 |
taaaattgcagacttcattgctaaggagcattaggatgcttctccccttctcatacacgcccc |
272 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45645704 |
taaaattgcagacttcactgctaaggagcattaggatgcttctccccttctcatacacgcccc |
45645766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 314 - 561
Target Start/End: Original strand, 45645808 - 45646051
Alignment:
| Q |
314 |
ataaagaaaataatacgtgtcatatcttgtttggtcgaacggaggtatatgcacactaaaaatcactatatagtgtataaaatatttaatttggaattct |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45645808 |
ataaagaaaataatacgtgtcatatcttgtttggtcgaacggaggtatatgcacactaaaaatcactatatagtgtataaaatatttaatttggaattct |
45645907 |
T |
 |
| Q |
414 |
atttacactttt-cattgtctacagtgcctgaatcaattatggtaataannnnnnngggtcaaagttatgataatggattttaactactcatattgactg |
512 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45645908 |
atttacactttttcattg-----agtgcctgaatcaattatggtaataatttttttgggtcaaagttatgataatggattttaactactcatattgaccg |
45646002 |
T |
 |
| Q |
513 |
catttattcatatcgcttatagggatatcgacaaaggtttgacgttctt |
561 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45646003 |
catttattcatatcgcttatagggatatcaacaaaggtttgacgttctt |
45646051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University