View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15656_high_8 (Length: 349)
Name: NF15656_high_8
Description: NF15656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15656_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 106 - 334
Target Start/End: Complemental strand, 51983331 - 51983103
Alignment:
| Q |
106 |
ggtgttaaaatgattatgaaatcgaaatttgttaaaatcgggtctgctatgttttcaatcgggtcagaagacctttcaagaggttgaagatgtatgcaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
51983331 |
ggtgttaaaatgattatgaaatcgaaatttgttaaaactgagtctgctatgttttcaatcgggtcaaaagacctttcaagaggttgaagatgtatgctca |
51983232 |
T |
 |
| Q |
206 |
taatttttaaattcagtcattcagttttgtgggcatgccccattttctcgaaccgactcaagcacttagtattaccaattttagtgccatatattattat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51983231 |
taatttttaaattcagtcattcagttttgtgggcgtgccccattttctcgaaccgactcaagcacttagtattaccaattttagtgccatatattattat |
51983132 |
T |
 |
| Q |
306 |
cataatttattggcagttacggtttgcat |
334 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
51983131 |
cataatttattggcagttacgatttgcat |
51983103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 51983405 - 51983373
Alignment:
| Q |
23 |
atacaccgaaacgttgagctcataaagaaaaac |
55 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
51983405 |
atacaccgaaacattgagctcataaagaaaaac |
51983373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 232 - 331
Target Start/End: Complemental strand, 36837983 - 36837884
Alignment:
| Q |
232 |
ttgtgggcatgccccattttctcgaaccgactcaagcacttagtatta-ccaattttagtgccatatattattatcataatttattggcagttacggttt |
330 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| | || |||| |||||||||| |||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
36837983 |
ttgtgggtgtgccccattttctccaaccgactcaagca-tcagcattaaccaattttagcgccatacattataatcataatttattggctgttacggttt |
36837885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University