View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15657_low_4 (Length: 230)

Name: NF15657_low_4
Description: NF15657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15657_low_4
NF15657_low_4
[»] chr2 (2 HSPs)
chr2 (144-217)||(15142562-15142641)
chr2 (91-146)||(15142471-15142526)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 15142562 - 15142641
Alignment:
144 tcaaaagtcaaaatacttcaagcaatcttgtggat------atgaaaggataaatcactgttgcaatcttatacttgcaa 217  Q
    |||||||||||||||||||||||||||||||||||      |||||||||||||||||| ||||||||||||||||||||    
15142562 tcaaaagtcaaaatacttcaagcaatcttgtggatatgtagatgaaaggataaatcactcttgcaatcttatacttgcaa 15142641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 91 - 146
Target Start/End: Original strand, 15142471 - 15142526
Alignment:
91 aatgtctggtctatacatttttgaatcaatttgcggtgagctatatatttaattca 146  Q
    ||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||    
15142471 aatgtctggtctatacaattttggatcaatttgcggtgaactatatatttaattca 15142526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University