View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15657_low_4 (Length: 230)
Name: NF15657_low_4
Description: NF15657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15657_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 15142562 - 15142641
Alignment:
| Q |
144 |
tcaaaagtcaaaatacttcaagcaatcttgtggat------atgaaaggataaatcactgttgcaatcttatacttgcaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15142562 |
tcaaaagtcaaaatacttcaagcaatcttgtggatatgtagatgaaaggataaatcactcttgcaatcttatacttgcaa |
15142641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 91 - 146
Target Start/End: Original strand, 15142471 - 15142526
Alignment:
| Q |
91 |
aatgtctggtctatacatttttgaatcaatttgcggtgagctatatatttaattca |
146 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
15142471 |
aatgtctggtctatacaattttggatcaatttgcggtgaactatatatttaattca |
15142526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University