View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15658_high_17 (Length: 318)
Name: NF15658_high_17
Description: NF15658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15658_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 10 - 300
Target Start/End: Original strand, 35004805 - 35005098
Alignment:
| Q |
10 |
atgaacattcaatgaaataagaattagccaggcttgacaaaagagaaataatta---aatttttaaataaggttattagagagatttgaattaaggttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35004805 |
atgaacattcaatgaaataagaattagccaggcttgacaaaagagaaataattattaaatttttaaatgaggttattagagagatttgaattaaggttga |
35004904 |
T |
 |
| Q |
107 |
tgaatgaagaagaggtaatgagaaacnnnnnnnttaaccataggttcaagtgggtggggttaattggaaggacttttgtttttctaccttttgtctttgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004905 |
tgaatgaagaagaggtaatgagaaacaaaaaaattaaccataggttcaagtgggtggggttaattggaaggacttttgtttttctaccttttgtctttgg |
35005004 |
T |
 |
| Q |
207 |
tgaggcttttgtatagttaaatggttattctatatttcatgagagcggaatattaggctatatattctctttgtttctcatgcttttatagttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005005 |
tgaggcttttgtatagttaaatggttattctatatttcatgagagcggaatattaggctatatattctctttgtttctcatgcttttatagttt |
35005098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University