View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15658_high_21 (Length: 253)
Name: NF15658_high_21
Description: NF15658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15658_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 240
Target Start/End: Original strand, 5900924 - 5901150
Alignment:
| Q |
14 |
tacttttcaaccctaattaatcaagaaaatgtgttctcaccgagattcgattgaggaactgcagcaggcactccattcgcattggttaacggaatacttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5900924 |
tacttttcaaccctaattaatcaagaaaatgtgttctcaccgagattcgcttgaggaactgcagcaggcactccattcgcattggttaacggaatacttt |
5901023 |
T |
 |
| Q |
114 |
tactagcattgtaaacattcataacattctgcacaccattcaagaacatctgaacccggttcttctcttgttccatacaaaccctttcttgatccaacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5901024 |
tactagcattgtaaacattcataacattctgcacaccattcaagaacatctgaacccggttcttctcttgttccatacaaaccctttcttgatccaacat |
5901123 |
T |
 |
| Q |
214 |
cactttctgctccttcaaacatatata |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5901124 |
cactttctgctccttcaaacatatata |
5901150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University