View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15658_low_22 (Length: 299)
Name: NF15658_low_22
Description: NF15658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15658_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 9093288 - 9093007
Alignment:
| Q |
1 |
gagtaaagagcaatggcgcagccagagtctcaacaataagggatcgtcaaagattttatataatttatttatttataactacaatataaatagagctatg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9093288 |
gagtaaagagcaatggcgcagctagagtctcaacaataagggatcgtcaaagattttatataattaatttatttataactacaatataaatagagctatg |
9093189 |
T |
 |
| Q |
101 |
tgttgcattttacatgaattattgataatgagagggaaggatcaaatatcttatttacatgaattatatagtcttttatgtatttgccattatactaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9093188 |
tgttgcattttacatgaattattgataatgagagggaaggatcaaatatcttatttacatgaattatatagtcttttatgtatatgccattatactaaac |
9093089 |
T |
 |
| Q |
201 |
tacatcataaatatgtcataactcataagtatcgataaatattaatagagatgcttatagattaatcacc-gataagatttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9093088 |
tacatcataaatatgtcataactcataagtatcgataaatattaatagagatgcttatagattaatcaccanataagatttt |
9093007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University