View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15658_low_26 (Length: 245)
Name: NF15658_low_26
Description: NF15658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15658_low_26 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 1803299 - 1803055
Alignment:
| Q |
1 |
tcaatgatatattcttcgacatctatttttatacttaatgcaagacttctaactcatattaactacacaagaatgaatttacttgtttatataaaaggaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1803299 |
tcaatgatatattcttcaacatctatttttatacttaatgcaagacttctaattcatattaactacacaaggatgaatttacttgtttatataaaaggaa |
1803200 |
T |
 |
| Q |
101 |
ggtgaagttttcatgaagtttaagacctatgtgtctgtatcaaacaaaatttaagtgtatcaacgaatttttcttttaatattctgtgcattccaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803199 |
ggtgaagttttcatgaagtttaagacctttgtgtctgtatcaaacaaaatttgagtgtatcaacgaatttttcttttaatattctgtgcattccaaatta |
1803100 |
T |
 |
| Q |
201 |
gacaaaagaatattctcttcaaaattttcttattctgaatagtat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803099 |
gacaaaagaatattctcttcaaaattttcttattctgaatagtat |
1803055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University