View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15658_low_28 (Length: 242)
Name: NF15658_low_28
Description: NF15658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15658_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 198
Target Start/End: Original strand, 1422685 - 1422875
Alignment:
| Q |
9 |
aggatcattaattagtgtaaaatttatgttaactttnnnnnnnntttccctttattaataacgcaataaaaactcaaattnnnnnnnnnn-ttgttttag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1422685 |
aggatcattaattagtgtaaaatttatgttaactttaaaaaaaaattccctttattaataacgcaataaaaactcaaattaaaaaaaaaaattgttttag |
1422784 |
T |
 |
| Q |
108 |
ttccctgatttgaatgaaaatatattagaatagagaggaaaatatgaaagtttcattattttgtttggtaagagcagtgaaaatttttgct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
1422785 |
ttccctgatttgaatgaaaatatattagaatagagaggaaaatatgaaagttccattattttgtttggcaagagcaatgaaaatttttgct |
1422875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University