View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_18 (Length: 417)
Name: NF15659_high_18
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 17 - 393
Target Start/End: Complemental strand, 3686048 - 3685664
Alignment:
| Q |
17 |
catatgtgcattaacggttatcaattccaaactcgggaattttttctcagtatttgttgttctctcaatctcatatgtgacagtttgtagtgctaaatg- |
115 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3686048 |
catatgttcattaacggttaccaattccaaactcgggaattttttctcagtatttgttgttctctcaatctcatatgtgacattttgtagcgctaaatga |
3685949 |
T |
|
| Q |
116 |
-------tgatagacttatcagtgttcatagggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacacaacctttcatgctt |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3685948 |
aaagatgtgatagacttatcagtgttcataaggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacgcaacctttcatgctt |
3685849 |
T |
|
| Q |
209 |
ggttgctcatcttatattgctagttatgcttcatcagtacgtggctgagcatcacctgttactgttaattcagattgcacaactatatgttcattgactg |
308 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685848 |
ggttgctcatcttatattgctagtcgtgcttcatcagtacgtggttgaaaatcacctgttactgttaattcagattgcacaactatatgttcattgactg |
3685749 |
T |
|
| Q |
309 |
gaggtgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685748 |
gaggtgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
3685664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University